Đăng nhập để hỏi chi tiết
Nguồn bài: High School Programing Offline 2002
Giới hạn thời gian: 2000ms Giới hạn bộ nhớ: 512MB
VIRUS
Victor likes to collect viruses (yes, this is a strange hobby). He has all sorts of harmless and harmful
ones that he keeps with him at all times (sealed up very securely of course). He is very attached to
his virus collection and he does not like to travel without it. So when he made plans to go to
Honolulu, Hawaii, his virus collection was sure to go with him. Unfortunately, Hawaii (unlike other
states) requires you to declare any viruses you may have in your possession. Because Hawaii
prohibits certain viruses from entering the state (they don’t want their fruit crops destroyed by a
rogue virus!), Victor is sure to leave any prohibited viruses at home so that they are not seized and
destroyed. Fortunately for Victor, the Hawaiian government has provided an informative website to
help Victor determine if his viruses are okay to enter Hawaii or not.
The Problem:
Your job is to help Victor determine which viruses he can take with him to Hawaii. The Hawaiian
government has provided on their website the exact sequences of DNA that are in the viruses that
are prohibited. So if the Hawaiian government said that the following sequence was prohibited:
ATTCCGTA
Then the following virus would be rejected because it contains that sequence:
ATTATTAGGATTACATTCCGTAACCGTTTTAG
However, the sequences may not have to be consecutive. They may have a fixed number of
“wildcards” (represented by the ASCII star character “*”) meaning that any DNA letter in a DNA
sequence will replace that wild card (but only one DNA letter per wildcard). For example, the
following sequence:
ATA**CGGC*A
Would reject the following virus DNA:
AGGAAATTACCCCATAGGCGGCTA
Dữ liệu nhập
You will read in a file that contains both the list of bad virus DNA sequences and then the DNA
sequences of Victor’s collection.
The first line of the file will contain a single positive integer that represents the number of data sets in
the file (unfortunately for Victor, the Hawaiian government updates their website several times a day
with new and/or different virus DNA so your program must be able to handle multiple, independent
data sets).
The first line of each data set will contain a single positive integer, n, (1<n<30) indicating how
many bad DNA subsequences were found on the Hawaii government’s website. The following n
lines will contain strings of DNA characters that will be at least 1 character long and at most 20
characters in length.
Following the bad DNA sequences will be a line containing a single positive
integer, m, (1<m<100) which will indicate how many viruses are in Victor’s collection. The
following mm lines will contain the DNA for his viruses. Each line will contain a string of DNA
characters that will be at least 1 character long and at most 200200 characters in length.
Notes to remember:
• The DNA alphabet only consists of the letters: A, C, G, and T.
• All letters will be uppercase.
• A “” in the bad DNA sequences indicates a wildcard which must be matched by any one DNA
letter in Victor’s virus DNA. There will be no “”s in the DNA sequences of Victor’s viruses.
• Bad virus DNA in one data set is NOT bad virus DNA in another data set.
Dữ liệu xuất
At the beginning of each data set, print the line:
Data set #k:
where k is the data set number starting with 1.
For each virus that you check for bad DNA sequences, print the following output if the virus is
acceptable in Hawaii:
Virus #d: Cool! Victor can take it with him!
Or print the following output if the virus is not acceptable in Hawaii (i.e. it matched one of the bad
DNA sequences):
Virus #d: Nuts. This virus is illegal in Hawaii!
Where d should be the virus number, starting with 1, for each data set. Other than
replacing d and k with the numbers as specified, the lines should be printed exactly as shown above
(watch your uppercase and lowercase letters as well as punctuation!). The output for each virus
should be on its own line (see the Sample Output below for an example).
Put a blank line in between data sets as a separator.
Ví dụ
input
2
3
ATTGG***A
**GTTGACCCCCC
GAGAGAGAGA
5
GATTGATTGAGAGAGAGATCATC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
GGGGGGGAAGTTGACCCCCC
AATTGGCATACCCCTTT
GGGGAAAATTTTAAAACCCCGGGGGAAAA
2
ATGG
ATGCATGCATGC
2
GCCGCCGCCTGCCGCCGCCT
ATATATGGATATATGGATATATGG
output
Data set #1:
Virus #1: Nuts. This virus is illegal in Hawaii!
Virus #2: Cool! Victor can take it with him!
Virus #3: Nuts. This virus is illegal in Hawaii!
Virus #4: Nuts. This virus is illegal in Hawaii!
Virus #5: Cool! Victor can take it with him!
Data set #2:
Virus #1: Cool! Victor can take it with him!
Virus #2: Nuts. This virus is illegal in Hawaii!
ko cần dịch, code c++ giúp em các anh ơi!
Hãy luôn nhớ cảm ơn và vote 5*
nếu câu trả lời hữu ích nhé!
TRẢ LỜI
#include <bits/stdc++.h>
using namespace std;
string Bad[105];
int main()
{
int T;
cin >> T;
for(int tc = 0; tc < T; tc++){
int n, m;
cin >> n;
for(int i = 0; i < n; i++)
cin >> Bad[i];
cin >> m;
cout << "Data set #" << tc + 1 << ":\n";
for(int v = 0; v < m; v++){
string virus;
cin >> virus;
bool cam = false;
for(int i = 0; i < n && !cam; i++){
int lenB = Bad[i].size();
int lenV = virus.size();
if(lenB > lenV) continue;
for(int st = 0; st + lenB <= lenV; st++){
bool khop = true;
for(int k = 0; k < lenB; k++){
if(Bad[i][k] != '*' && Bad[i][k] != virus[st + k]){
khop = false;
break;
}
}
if(khop){
cam = true;
break;
}
}
}
if(cam)
cout << "Virus #" << v + 1 << ": Nuts. This virus is illegal in Hawaii!\n";
else
cout << "Virus #" << v + 1 << ": Cool! Victor can take it with him!\n";
}
if(tc < T - 1)
cout << "\n";
}
return 0;
}
Hãy giúp mọi người biết câu trả lời này thế nào?
51 vote
#include <bits/stdc++.h>
using namespace std;
bool match(string virus, string pat) {
int n = virus.size();
int m = pat.size();
for (int i = 0; i + m <= n; i++) {
bool ok = true;
for (int j = 0; j < m; j++) {
if (pat[j] != '*' && pat[j] != virus[i+j]) {
ok = false;
break;
}
}
if (ok) return true;
}
return false;
}
int main() {
ios::sync_with_stdio(false);
cin.tie(NULL);
int T;
cin >> T;
for (int k = 1; k <= T; k++) {
int n;
cin >> n;
vector<string> bad(n);
for (int i = 0; i < n; i++)
cin >> bad[i];
int m;
cin >> m;
cout << "Data set #" << k << ":\n";
for (int i = 1; i <= m; i++) {
string virus;
cin >> virus;
bool illegal = false;
for (string pat : bad) {
if (match(virus, pat)) {
illegal = true;
break;
}
}
if (illegal)
cout << "Virus #" << i << ": Nuts. This virus is illegal in Hawaii!\n";
else
cout << "Virus #" << i << ": Cool! Victor can take it with him!\n";
}
if (k != T) cout << "\n";
}
}Hãy giúp mọi người biết câu trả lời này thế nào?
51 vote
Bạn muốn hỏi điều gì?
Đặt câu hỏiPH/HS Tham Gia Nhóm Lớp 10 Để Trao Đổi Tài Liệu, Học Tập Miễn Phí!
Bảng tin
Bạn muốn hỏi điều gì?
Đặt câu hỏi
Cơ quan chủ quản: Công ty Cổ phần Công nghệ Giáo dục Thành Phát
Tải ứng dụng
Inbox: m.me/hoidap247online
Trụ sở: Tầng 7, Tòa Intracom, số 82 Dịch Vọng Hậu, Cầu Giấy, Hà Nội.
Giấy phép thiết lập mạng xã hội trên mạng số 331/GP-BTTTT do Bộ Thông tin và Truyền thông.
13
299
2
hay quá bạn